Review



short hairpin rna shrna sequence  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 96

    Structured Review

    Addgene inc short hairpin rna shrna sequence
    (a) Bar graphs showing Smarcc2 mRNA levels in N2A cells transfected with control vs. Smarcc2 <t>shRNA.</t> n=15-16 cultures/group; t 29 =20.3, p <0.001, unpaired t test. (b) Representative low-magnification (2×) image showing the AAV injection site and bar graphs displaying Smarcc2 mRNA and protein levels in mouse PFC injected with control vs. Smarcc2 shRNA AAV. Inset: immunoblots of Smarcc2 and Histone H3. mRNA: n=12-15 mice/group; t 25 =4.78, p <0.001. Protein: n=9-11 mice/group; t 18 =5.9, p <0.001. Scale bars: 0.5 mm. (c) Representative confocal images (63×) showing immunostaining of Smarcc2 (red) and NeuN (blue). Scale bars: 20 μm. (d) Quantification of the fluorescence intensity of Samrcc2 and the number of NeuN+ cells. n=9-12 images/3-4 mice/ group. Smarcc2 intensity: t 19 =7.4, p <0.001, unpaired t test. (e) Plot showing the percentage of correct responses in various trials of spontaneous T-maze tests of control vs. Smarcc2 KD mice. n=31-41 mice/group. p <0.001, unpaired t test; (f) Bar graphs showing the spatial memory index and latency to the correct hole in Barnes Maze (BM) tests of control vs. Smarcc2 KD female mice. n=15-16 mice/group. Index: p =0.03, M-W test; latency: t 23.6 =3.26, p =0.034, Welch’s t test. (g) Bar graphs showing the social preference index and time spent on social (Soc) and non-social (NS) objects in three-chamber social preference tests of control vs. Smarcc2 KD mice. n=22-27 mice/group. Time: F 1,94 =147.5, ### p <0.001, Soc vs. NS, two-way ANOVA. (h) Bar graphs showing the time spent in light box and the number of entries into the light box in light-dark box tests of control vs. Smarcc2 KD mice. n=12-15 mice/group. (i) Bar graphs showing the time in open arms and number of entries into open arms in elevated plus maze (EPM) tests of control vs. Smarcc2 KD mice. n=24-31 mice/group. (j) Bar graphs showing time spent in the center area of open field, the number of entries to center area, and the total distance traveled in open field (OF) tests of control vs. Smarcc2 KD mice. n=18-22 mice/group. (k) Bar graph showing the grooming time in grooming tests of control vs. Smarcc2 KD mice. n=10-14 mice/group. (l) Bar graphs showing the number and time of aggressive encounters and total interactions in resident-intruder (RI) tests of control vs. Smarcc2 KD mice. n=9-12 mice/group. All data are shown as mean ± SEM, * p <0.05, *** p <0.001.
    Short Hairpin Rna Shrna Sequence, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1377 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/short hairpin rna shrna sequence/product/Addgene inc
    Average 96 stars, based on 1377 article reviews
    short hairpin rna shrna sequence - by Bioz Stars, 2026-03
    96/100 stars

    Images

    1) Product Images from "Cognitive and Synaptic Impairment Induced by Deficiency of Autism Risk Gene Smarcc2 and its Rescue by Histone Deacetylase Inhibition"

    Article Title: Cognitive and Synaptic Impairment Induced by Deficiency of Autism Risk Gene Smarcc2 and its Rescue by Histone Deacetylase Inhibition

    Journal: bioRxiv

    doi: 10.1101/2025.05.29.656867

    (a) Bar graphs showing Smarcc2 mRNA levels in N2A cells transfected with control vs. Smarcc2 shRNA. n=15-16 cultures/group; t 29 =20.3, p <0.001, unpaired t test. (b) Representative low-magnification (2×) image showing the AAV injection site and bar graphs displaying Smarcc2 mRNA and protein levels in mouse PFC injected with control vs. Smarcc2 shRNA AAV. Inset: immunoblots of Smarcc2 and Histone H3. mRNA: n=12-15 mice/group; t 25 =4.78, p <0.001. Protein: n=9-11 mice/group; t 18 =5.9, p <0.001. Scale bars: 0.5 mm. (c) Representative confocal images (63×) showing immunostaining of Smarcc2 (red) and NeuN (blue). Scale bars: 20 μm. (d) Quantification of the fluorescence intensity of Samrcc2 and the number of NeuN+ cells. n=9-12 images/3-4 mice/ group. Smarcc2 intensity: t 19 =7.4, p <0.001, unpaired t test. (e) Plot showing the percentage of correct responses in various trials of spontaneous T-maze tests of control vs. Smarcc2 KD mice. n=31-41 mice/group. p <0.001, unpaired t test; (f) Bar graphs showing the spatial memory index and latency to the correct hole in Barnes Maze (BM) tests of control vs. Smarcc2 KD female mice. n=15-16 mice/group. Index: p =0.03, M-W test; latency: t 23.6 =3.26, p =0.034, Welch’s t test. (g) Bar graphs showing the social preference index and time spent on social (Soc) and non-social (NS) objects in three-chamber social preference tests of control vs. Smarcc2 KD mice. n=22-27 mice/group. Time: F 1,94 =147.5, ### p <0.001, Soc vs. NS, two-way ANOVA. (h) Bar graphs showing the time spent in light box and the number of entries into the light box in light-dark box tests of control vs. Smarcc2 KD mice. n=12-15 mice/group. (i) Bar graphs showing the time in open arms and number of entries into open arms in elevated plus maze (EPM) tests of control vs. Smarcc2 KD mice. n=24-31 mice/group. (j) Bar graphs showing time spent in the center area of open field, the number of entries to center area, and the total distance traveled in open field (OF) tests of control vs. Smarcc2 KD mice. n=18-22 mice/group. (k) Bar graph showing the grooming time in grooming tests of control vs. Smarcc2 KD mice. n=10-14 mice/group. (l) Bar graphs showing the number and time of aggressive encounters and total interactions in resident-intruder (RI) tests of control vs. Smarcc2 KD mice. n=9-12 mice/group. All data are shown as mean ± SEM, * p <0.05, *** p <0.001.
    Figure Legend Snippet: (a) Bar graphs showing Smarcc2 mRNA levels in N2A cells transfected with control vs. Smarcc2 shRNA. n=15-16 cultures/group; t 29 =20.3, p <0.001, unpaired t test. (b) Representative low-magnification (2×) image showing the AAV injection site and bar graphs displaying Smarcc2 mRNA and protein levels in mouse PFC injected with control vs. Smarcc2 shRNA AAV. Inset: immunoblots of Smarcc2 and Histone H3. mRNA: n=12-15 mice/group; t 25 =4.78, p <0.001. Protein: n=9-11 mice/group; t 18 =5.9, p <0.001. Scale bars: 0.5 mm. (c) Representative confocal images (63×) showing immunostaining of Smarcc2 (red) and NeuN (blue). Scale bars: 20 μm. (d) Quantification of the fluorescence intensity of Samrcc2 and the number of NeuN+ cells. n=9-12 images/3-4 mice/ group. Smarcc2 intensity: t 19 =7.4, p <0.001, unpaired t test. (e) Plot showing the percentage of correct responses in various trials of spontaneous T-maze tests of control vs. Smarcc2 KD mice. n=31-41 mice/group. p <0.001, unpaired t test; (f) Bar graphs showing the spatial memory index and latency to the correct hole in Barnes Maze (BM) tests of control vs. Smarcc2 KD female mice. n=15-16 mice/group. Index: p =0.03, M-W test; latency: t 23.6 =3.26, p =0.034, Welch’s t test. (g) Bar graphs showing the social preference index and time spent on social (Soc) and non-social (NS) objects in three-chamber social preference tests of control vs. Smarcc2 KD mice. n=22-27 mice/group. Time: F 1,94 =147.5, ### p <0.001, Soc vs. NS, two-way ANOVA. (h) Bar graphs showing the time spent in light box and the number of entries into the light box in light-dark box tests of control vs. Smarcc2 KD mice. n=12-15 mice/group. (i) Bar graphs showing the time in open arms and number of entries into open arms in elevated plus maze (EPM) tests of control vs. Smarcc2 KD mice. n=24-31 mice/group. (j) Bar graphs showing time spent in the center area of open field, the number of entries to center area, and the total distance traveled in open field (OF) tests of control vs. Smarcc2 KD mice. n=18-22 mice/group. (k) Bar graph showing the grooming time in grooming tests of control vs. Smarcc2 KD mice. n=10-14 mice/group. (l) Bar graphs showing the number and time of aggressive encounters and total interactions in resident-intruder (RI) tests of control vs. Smarcc2 KD mice. n=9-12 mice/group. All data are shown as mean ± SEM, * p <0.05, *** p <0.001.

    Techniques Used: Transfection, Control, shRNA, Injection, Western Blot, Immunostaining, Fluorescence

    (a, b) Bar graphs showing the level of H3K9ac, H3K27ac, H3K27me3, and H3K4me3 in N2A cells transfected with control vs. Smarcc2 shRNA (a) or PFC tissue from mice injected with control vs. Smarcc2 shRNA AAV (b). a, n=6-7 cultures/group, H3K9ac: t 12 =5.5, p <0.001; H3K27ac: t 10 =3.3, p =0.008; b, n=9-11 mice/group, H3K9ac: t 18 =5.3, p <0.001; H3K27ac: t 16 =2.7, p =0.016. (c) Representative immunoblots of co-IP experiments showing HDAC2-bound Smarcc2 in control vs. Smarcc2 KD mice. Anti-HDAC2 was used for IP, anti-Smarcc2, anti-HDAC2 and anti-HDAC1 was used for blotting. No antibody and IgG were used as negative controls for IP. (d) Diagram showing H3K9ac occupancy at Slc1a3, Slc6a1, and Slc32a1 promotor regions, including the location of primers used in ChIP-PCR assays (light blue rectangular area). (e) ChIP assay data showing differential H3K9ac levels at Slc1a3, Slc6a1 and Slc32a1 promoters in the PFC of control vs. Smarcc2 KD mice. n=3-6 mice/group. Slc1a3 : t 15 =3.5, p =0.003; Slc6a1 : t 6 =3.8, p =0.009; Slc32a1 : t 5 =3.2, p =0.02, unpaired t test. All data are shown as mean ± SEM. * p <0.05, ** p <0.01, *** p <0.001.
    Figure Legend Snippet: (a, b) Bar graphs showing the level of H3K9ac, H3K27ac, H3K27me3, and H3K4me3 in N2A cells transfected with control vs. Smarcc2 shRNA (a) or PFC tissue from mice injected with control vs. Smarcc2 shRNA AAV (b). a, n=6-7 cultures/group, H3K9ac: t 12 =5.5, p <0.001; H3K27ac: t 10 =3.3, p =0.008; b, n=9-11 mice/group, H3K9ac: t 18 =5.3, p <0.001; H3K27ac: t 16 =2.7, p =0.016. (c) Representative immunoblots of co-IP experiments showing HDAC2-bound Smarcc2 in control vs. Smarcc2 KD mice. Anti-HDAC2 was used for IP, anti-Smarcc2, anti-HDAC2 and anti-HDAC1 was used for blotting. No antibody and IgG were used as negative controls for IP. (d) Diagram showing H3K9ac occupancy at Slc1a3, Slc6a1, and Slc32a1 promotor regions, including the location of primers used in ChIP-PCR assays (light blue rectangular area). (e) ChIP assay data showing differential H3K9ac levels at Slc1a3, Slc6a1 and Slc32a1 promoters in the PFC of control vs. Smarcc2 KD mice. n=3-6 mice/group. Slc1a3 : t 15 =3.5, p =0.003; Slc6a1 : t 6 =3.8, p =0.009; Slc32a1 : t 5 =3.2, p =0.02, unpaired t test. All data are shown as mean ± SEM. * p <0.05, ** p <0.01, *** p <0.001.

    Techniques Used: Transfection, Control, shRNA, Injection, Western Blot, Co-Immunoprecipitation Assay



    Similar Products

    90
    Santa Cruz Biotechnology lentiviral particles plko.1 with short hairpin rnas (shrnas) containing nmnat1 and nmnat3 -specific sequences
    Lentiviral Particles Plko.1 With Short Hairpin Rnas (Shrnas) Containing Nmnat1 And Nmnat3 Specific Sequences, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/lentiviral particles plko.1 with short hairpin rnas (shrnas) containing nmnat1 and nmnat3 -specific sequences/product/Santa Cruz Biotechnology
    Average 90 stars, based on 1 article reviews
    lentiviral particles plko.1 with short hairpin rnas (shrnas) containing nmnat1 and nmnat3 -specific sequences - by Bioz Stars, 2026-03
    90/100 stars
      Buy from Supplier

    90
    Shanghai Genechem Ltd vim-as1 recombinant shuttle plasmid with distinct short hairpin rna (shrna) sequences aimed at lncrna vimas1
    Vim As1 Recombinant Shuttle Plasmid With Distinct Short Hairpin Rna (Shrna) Sequences Aimed At Lncrna Vimas1, supplied by Shanghai Genechem Ltd, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/vim-as1 recombinant shuttle plasmid with distinct short hairpin rna (shrna) sequences aimed at lncrna vimas1/product/Shanghai Genechem Ltd
    Average 90 stars, based on 1 article reviews
    vim-as1 recombinant shuttle plasmid with distinct short hairpin rna (shrna) sequences aimed at lncrna vimas1 - by Bioz Stars, 2026-03
    90/100 stars
      Buy from Supplier

    90
    Shanghai Genechem Ltd recombinant shuttle plasmid with distinct short hairpin rna (shrna) sequences aimed at lncrna vim-as1
    Recombinant Shuttle Plasmid With Distinct Short Hairpin Rna (Shrna) Sequences Aimed At Lncrna Vim As1, supplied by Shanghai Genechem Ltd, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/recombinant shuttle plasmid with distinct short hairpin rna (shrna) sequences aimed at lncrna vim-as1/product/Shanghai Genechem Ltd
    Average 90 stars, based on 1 article reviews
    recombinant shuttle plasmid with distinct short hairpin rna (shrna) sequences aimed at lncrna vim-as1 - by Bioz Stars, 2026-03
    90/100 stars
      Buy from Supplier

    96
    Addgene inc short hairpin rna shrna sequence
    (a) Bar graphs showing Smarcc2 mRNA levels in N2A cells transfected with control vs. Smarcc2 <t>shRNA.</t> n=15-16 cultures/group; t 29 =20.3, p <0.001, unpaired t test. (b) Representative low-magnification (2×) image showing the AAV injection site and bar graphs displaying Smarcc2 mRNA and protein levels in mouse PFC injected with control vs. Smarcc2 shRNA AAV. Inset: immunoblots of Smarcc2 and Histone H3. mRNA: n=12-15 mice/group; t 25 =4.78, p <0.001. Protein: n=9-11 mice/group; t 18 =5.9, p <0.001. Scale bars: 0.5 mm. (c) Representative confocal images (63×) showing immunostaining of Smarcc2 (red) and NeuN (blue). Scale bars: 20 μm. (d) Quantification of the fluorescence intensity of Samrcc2 and the number of NeuN+ cells. n=9-12 images/3-4 mice/ group. Smarcc2 intensity: t 19 =7.4, p <0.001, unpaired t test. (e) Plot showing the percentage of correct responses in various trials of spontaneous T-maze tests of control vs. Smarcc2 KD mice. n=31-41 mice/group. p <0.001, unpaired t test; (f) Bar graphs showing the spatial memory index and latency to the correct hole in Barnes Maze (BM) tests of control vs. Smarcc2 KD female mice. n=15-16 mice/group. Index: p =0.03, M-W test; latency: t 23.6 =3.26, p =0.034, Welch’s t test. (g) Bar graphs showing the social preference index and time spent on social (Soc) and non-social (NS) objects in three-chamber social preference tests of control vs. Smarcc2 KD mice. n=22-27 mice/group. Time: F 1,94 =147.5, ### p <0.001, Soc vs. NS, two-way ANOVA. (h) Bar graphs showing the time spent in light box and the number of entries into the light box in light-dark box tests of control vs. Smarcc2 KD mice. n=12-15 mice/group. (i) Bar graphs showing the time in open arms and number of entries into open arms in elevated plus maze (EPM) tests of control vs. Smarcc2 KD mice. n=24-31 mice/group. (j) Bar graphs showing time spent in the center area of open field, the number of entries to center area, and the total distance traveled in open field (OF) tests of control vs. Smarcc2 KD mice. n=18-22 mice/group. (k) Bar graph showing the grooming time in grooming tests of control vs. Smarcc2 KD mice. n=10-14 mice/group. (l) Bar graphs showing the number and time of aggressive encounters and total interactions in resident-intruder (RI) tests of control vs. Smarcc2 KD mice. n=9-12 mice/group. All data are shown as mean ± SEM, * p <0.05, *** p <0.001.
    Short Hairpin Rna Shrna Sequence, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/short hairpin rna shrna sequence/product/Addgene inc
    Average 96 stars, based on 1 article reviews
    short hairpin rna shrna sequence - by Bioz Stars, 2026-03
    96/100 stars
      Buy from Supplier

    90
    Genechem lentiviral constructs expressing short hairpin rnas (shrnas) and cmv promoter sequences
    (a) Bar graphs showing Smarcc2 mRNA levels in N2A cells transfected with control vs. Smarcc2 <t>shRNA.</t> n=15-16 cultures/group; t 29 =20.3, p <0.001, unpaired t test. (b) Representative low-magnification (2×) image showing the AAV injection site and bar graphs displaying Smarcc2 mRNA and protein levels in mouse PFC injected with control vs. Smarcc2 shRNA AAV. Inset: immunoblots of Smarcc2 and Histone H3. mRNA: n=12-15 mice/group; t 25 =4.78, p <0.001. Protein: n=9-11 mice/group; t 18 =5.9, p <0.001. Scale bars: 0.5 mm. (c) Representative confocal images (63×) showing immunostaining of Smarcc2 (red) and NeuN (blue). Scale bars: 20 μm. (d) Quantification of the fluorescence intensity of Samrcc2 and the number of NeuN+ cells. n=9-12 images/3-4 mice/ group. Smarcc2 intensity: t 19 =7.4, p <0.001, unpaired t test. (e) Plot showing the percentage of correct responses in various trials of spontaneous T-maze tests of control vs. Smarcc2 KD mice. n=31-41 mice/group. p <0.001, unpaired t test; (f) Bar graphs showing the spatial memory index and latency to the correct hole in Barnes Maze (BM) tests of control vs. Smarcc2 KD female mice. n=15-16 mice/group. Index: p =0.03, M-W test; latency: t 23.6 =3.26, p =0.034, Welch’s t test. (g) Bar graphs showing the social preference index and time spent on social (Soc) and non-social (NS) objects in three-chamber social preference tests of control vs. Smarcc2 KD mice. n=22-27 mice/group. Time: F 1,94 =147.5, ### p <0.001, Soc vs. NS, two-way ANOVA. (h) Bar graphs showing the time spent in light box and the number of entries into the light box in light-dark box tests of control vs. Smarcc2 KD mice. n=12-15 mice/group. (i) Bar graphs showing the time in open arms and number of entries into open arms in elevated plus maze (EPM) tests of control vs. Smarcc2 KD mice. n=24-31 mice/group. (j) Bar graphs showing time spent in the center area of open field, the number of entries to center area, and the total distance traveled in open field (OF) tests of control vs. Smarcc2 KD mice. n=18-22 mice/group. (k) Bar graph showing the grooming time in grooming tests of control vs. Smarcc2 KD mice. n=10-14 mice/group. (l) Bar graphs showing the number and time of aggressive encounters and total interactions in resident-intruder (RI) tests of control vs. Smarcc2 KD mice. n=9-12 mice/group. All data are shown as mean ± SEM, * p <0.05, *** p <0.001.
    Lentiviral Constructs Expressing Short Hairpin Rnas (Shrnas) And Cmv Promoter Sequences, supplied by Genechem, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/lentiviral constructs expressing short hairpin rnas (shrnas) and cmv promoter sequences/product/Genechem
    Average 90 stars, based on 1 article reviews
    lentiviral constructs expressing short hairpin rnas (shrnas) and cmv promoter sequences - by Bioz Stars, 2026-03
    90/100 stars
      Buy from Supplier

    96
    Addgene inc hairpin shrna sequence
    (a) Bar graphs showing Smarcc2 mRNA levels in N2A cells transfected with control vs. Smarcc2 <t>shRNA.</t> n=15-16 cultures/group; t 29 =20.3, p <0.001, unpaired t test. (b) Representative low-magnification (2×) image showing the AAV injection site and bar graphs displaying Smarcc2 mRNA and protein levels in mouse PFC injected with control vs. Smarcc2 shRNA AAV. Inset: immunoblots of Smarcc2 and Histone H3. mRNA: n=12-15 mice/group; t 25 =4.78, p <0.001. Protein: n=9-11 mice/group; t 18 =5.9, p <0.001. Scale bars: 0.5 mm. (c) Representative confocal images (63×) showing immunostaining of Smarcc2 (red) and NeuN (blue). Scale bars: 20 μm. (d) Quantification of the fluorescence intensity of Samrcc2 and the number of NeuN+ cells. n=9-12 images/3-4 mice/ group. Smarcc2 intensity: t 19 =7.4, p <0.001, unpaired t test. (e) Plot showing the percentage of correct responses in various trials of spontaneous T-maze tests of control vs. Smarcc2 KD mice. n=31-41 mice/group. p <0.001, unpaired t test; (f) Bar graphs showing the spatial memory index and latency to the correct hole in Barnes Maze (BM) tests of control vs. Smarcc2 KD female mice. n=15-16 mice/group. Index: p =0.03, M-W test; latency: t 23.6 =3.26, p =0.034, Welch’s t test. (g) Bar graphs showing the social preference index and time spent on social (Soc) and non-social (NS) objects in three-chamber social preference tests of control vs. Smarcc2 KD mice. n=22-27 mice/group. Time: F 1,94 =147.5, ### p <0.001, Soc vs. NS, two-way ANOVA. (h) Bar graphs showing the time spent in light box and the number of entries into the light box in light-dark box tests of control vs. Smarcc2 KD mice. n=12-15 mice/group. (i) Bar graphs showing the time in open arms and number of entries into open arms in elevated plus maze (EPM) tests of control vs. Smarcc2 KD mice. n=24-31 mice/group. (j) Bar graphs showing time spent in the center area of open field, the number of entries to center area, and the total distance traveled in open field (OF) tests of control vs. Smarcc2 KD mice. n=18-22 mice/group. (k) Bar graph showing the grooming time in grooming tests of control vs. Smarcc2 KD mice. n=10-14 mice/group. (l) Bar graphs showing the number and time of aggressive encounters and total interactions in resident-intruder (RI) tests of control vs. Smarcc2 KD mice. n=9-12 mice/group. All data are shown as mean ± SEM, * p <0.05, *** p <0.001.
    Hairpin Shrna Sequence, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/hairpin shrna sequence/product/Addgene inc
    Average 96 stars, based on 1 article reviews
    hairpin shrna sequence - by Bioz Stars, 2026-03
    96/100 stars
      Buy from Supplier

    96
    Addgene inc short hairpin rna shrna sequences targeting tpx2
    Correlations between <t> TPX2 </t> expression in tissues and clinicopathologic characteristics of type 2 pRCC patients
    Short Hairpin Rna Shrna Sequences Targeting Tpx2, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/short hairpin rna shrna sequences targeting tpx2/product/Addgene inc
    Average 96 stars, based on 1 article reviews
    short hairpin rna shrna sequences targeting tpx2 - by Bioz Stars, 2026-03
    96/100 stars
      Buy from Supplier

    96
    Addgene inc short hairpin rna shrna sequences
    Correlations between <t> TPX2 </t> expression in tissues and clinicopathologic characteristics of type 2 pRCC patients
    Short Hairpin Rna Shrna Sequences, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/short hairpin rna shrna sequences/product/Addgene inc
    Average 96 stars, based on 1 article reviews
    short hairpin rna shrna sequences - by Bioz Stars, 2026-03
    96/100 stars
      Buy from Supplier

    Image Search Results


    (a) Bar graphs showing Smarcc2 mRNA levels in N2A cells transfected with control vs. Smarcc2 shRNA. n=15-16 cultures/group; t 29 =20.3, p <0.001, unpaired t test. (b) Representative low-magnification (2×) image showing the AAV injection site and bar graphs displaying Smarcc2 mRNA and protein levels in mouse PFC injected with control vs. Smarcc2 shRNA AAV. Inset: immunoblots of Smarcc2 and Histone H3. mRNA: n=12-15 mice/group; t 25 =4.78, p <0.001. Protein: n=9-11 mice/group; t 18 =5.9, p <0.001. Scale bars: 0.5 mm. (c) Representative confocal images (63×) showing immunostaining of Smarcc2 (red) and NeuN (blue). Scale bars: 20 μm. (d) Quantification of the fluorescence intensity of Samrcc2 and the number of NeuN+ cells. n=9-12 images/3-4 mice/ group. Smarcc2 intensity: t 19 =7.4, p <0.001, unpaired t test. (e) Plot showing the percentage of correct responses in various trials of spontaneous T-maze tests of control vs. Smarcc2 KD mice. n=31-41 mice/group. p <0.001, unpaired t test; (f) Bar graphs showing the spatial memory index and latency to the correct hole in Barnes Maze (BM) tests of control vs. Smarcc2 KD female mice. n=15-16 mice/group. Index: p =0.03, M-W test; latency: t 23.6 =3.26, p =0.034, Welch’s t test. (g) Bar graphs showing the social preference index and time spent on social (Soc) and non-social (NS) objects in three-chamber social preference tests of control vs. Smarcc2 KD mice. n=22-27 mice/group. Time: F 1,94 =147.5, ### p <0.001, Soc vs. NS, two-way ANOVA. (h) Bar graphs showing the time spent in light box and the number of entries into the light box in light-dark box tests of control vs. Smarcc2 KD mice. n=12-15 mice/group. (i) Bar graphs showing the time in open arms and number of entries into open arms in elevated plus maze (EPM) tests of control vs. Smarcc2 KD mice. n=24-31 mice/group. (j) Bar graphs showing time spent in the center area of open field, the number of entries to center area, and the total distance traveled in open field (OF) tests of control vs. Smarcc2 KD mice. n=18-22 mice/group. (k) Bar graph showing the grooming time in grooming tests of control vs. Smarcc2 KD mice. n=10-14 mice/group. (l) Bar graphs showing the number and time of aggressive encounters and total interactions in resident-intruder (RI) tests of control vs. Smarcc2 KD mice. n=9-12 mice/group. All data are shown as mean ± SEM, * p <0.05, *** p <0.001.

    Journal: bioRxiv

    Article Title: Cognitive and Synaptic Impairment Induced by Deficiency of Autism Risk Gene Smarcc2 and its Rescue by Histone Deacetylase Inhibition

    doi: 10.1101/2025.05.29.656867

    Figure Lengend Snippet: (a) Bar graphs showing Smarcc2 mRNA levels in N2A cells transfected with control vs. Smarcc2 shRNA. n=15-16 cultures/group; t 29 =20.3, p <0.001, unpaired t test. (b) Representative low-magnification (2×) image showing the AAV injection site and bar graphs displaying Smarcc2 mRNA and protein levels in mouse PFC injected with control vs. Smarcc2 shRNA AAV. Inset: immunoblots of Smarcc2 and Histone H3. mRNA: n=12-15 mice/group; t 25 =4.78, p <0.001. Protein: n=9-11 mice/group; t 18 =5.9, p <0.001. Scale bars: 0.5 mm. (c) Representative confocal images (63×) showing immunostaining of Smarcc2 (red) and NeuN (blue). Scale bars: 20 μm. (d) Quantification of the fluorescence intensity of Samrcc2 and the number of NeuN+ cells. n=9-12 images/3-4 mice/ group. Smarcc2 intensity: t 19 =7.4, p <0.001, unpaired t test. (e) Plot showing the percentage of correct responses in various trials of spontaneous T-maze tests of control vs. Smarcc2 KD mice. n=31-41 mice/group. p <0.001, unpaired t test; (f) Bar graphs showing the spatial memory index and latency to the correct hole in Barnes Maze (BM) tests of control vs. Smarcc2 KD female mice. n=15-16 mice/group. Index: p =0.03, M-W test; latency: t 23.6 =3.26, p =0.034, Welch’s t test. (g) Bar graphs showing the social preference index and time spent on social (Soc) and non-social (NS) objects in three-chamber social preference tests of control vs. Smarcc2 KD mice. n=22-27 mice/group. Time: F 1,94 =147.5, ### p <0.001, Soc vs. NS, two-way ANOVA. (h) Bar graphs showing the time spent in light box and the number of entries into the light box in light-dark box tests of control vs. Smarcc2 KD mice. n=12-15 mice/group. (i) Bar graphs showing the time in open arms and number of entries into open arms in elevated plus maze (EPM) tests of control vs. Smarcc2 KD mice. n=24-31 mice/group. (j) Bar graphs showing time spent in the center area of open field, the number of entries to center area, and the total distance traveled in open field (OF) tests of control vs. Smarcc2 KD mice. n=18-22 mice/group. (k) Bar graph showing the grooming time in grooming tests of control vs. Smarcc2 KD mice. n=10-14 mice/group. (l) Bar graphs showing the number and time of aggressive encounters and total interactions in resident-intruder (RI) tests of control vs. Smarcc2 KD mice. n=9-12 mice/group. All data are shown as mean ± SEM, * p <0.05, *** p <0.001.

    Article Snippet: To knockdown Smarcc2 , a short hairpin RNA (shRNA) sequence (CCCGATAGTTGATCCTGAGAA) was cloned into GFP-tagged adeno-associated virus (AAV) vector (Addgene) under the control of U6 promotor.

    Techniques: Transfection, Control, shRNA, Injection, Western Blot, Immunostaining, Fluorescence

    (a, b) Bar graphs showing the level of H3K9ac, H3K27ac, H3K27me3, and H3K4me3 in N2A cells transfected with control vs. Smarcc2 shRNA (a) or PFC tissue from mice injected with control vs. Smarcc2 shRNA AAV (b). a, n=6-7 cultures/group, H3K9ac: t 12 =5.5, p <0.001; H3K27ac: t 10 =3.3, p =0.008; b, n=9-11 mice/group, H3K9ac: t 18 =5.3, p <0.001; H3K27ac: t 16 =2.7, p =0.016. (c) Representative immunoblots of co-IP experiments showing HDAC2-bound Smarcc2 in control vs. Smarcc2 KD mice. Anti-HDAC2 was used for IP, anti-Smarcc2, anti-HDAC2 and anti-HDAC1 was used for blotting. No antibody and IgG were used as negative controls for IP. (d) Diagram showing H3K9ac occupancy at Slc1a3, Slc6a1, and Slc32a1 promotor regions, including the location of primers used in ChIP-PCR assays (light blue rectangular area). (e) ChIP assay data showing differential H3K9ac levels at Slc1a3, Slc6a1 and Slc32a1 promoters in the PFC of control vs. Smarcc2 KD mice. n=3-6 mice/group. Slc1a3 : t 15 =3.5, p =0.003; Slc6a1 : t 6 =3.8, p =0.009; Slc32a1 : t 5 =3.2, p =0.02, unpaired t test. All data are shown as mean ± SEM. * p <0.05, ** p <0.01, *** p <0.001.

    Journal: bioRxiv

    Article Title: Cognitive and Synaptic Impairment Induced by Deficiency of Autism Risk Gene Smarcc2 and its Rescue by Histone Deacetylase Inhibition

    doi: 10.1101/2025.05.29.656867

    Figure Lengend Snippet: (a, b) Bar graphs showing the level of H3K9ac, H3K27ac, H3K27me3, and H3K4me3 in N2A cells transfected with control vs. Smarcc2 shRNA (a) or PFC tissue from mice injected with control vs. Smarcc2 shRNA AAV (b). a, n=6-7 cultures/group, H3K9ac: t 12 =5.5, p <0.001; H3K27ac: t 10 =3.3, p =0.008; b, n=9-11 mice/group, H3K9ac: t 18 =5.3, p <0.001; H3K27ac: t 16 =2.7, p =0.016. (c) Representative immunoblots of co-IP experiments showing HDAC2-bound Smarcc2 in control vs. Smarcc2 KD mice. Anti-HDAC2 was used for IP, anti-Smarcc2, anti-HDAC2 and anti-HDAC1 was used for blotting. No antibody and IgG were used as negative controls for IP. (d) Diagram showing H3K9ac occupancy at Slc1a3, Slc6a1, and Slc32a1 promotor regions, including the location of primers used in ChIP-PCR assays (light blue rectangular area). (e) ChIP assay data showing differential H3K9ac levels at Slc1a3, Slc6a1 and Slc32a1 promoters in the PFC of control vs. Smarcc2 KD mice. n=3-6 mice/group. Slc1a3 : t 15 =3.5, p =0.003; Slc6a1 : t 6 =3.8, p =0.009; Slc32a1 : t 5 =3.2, p =0.02, unpaired t test. All data are shown as mean ± SEM. * p <0.05, ** p <0.01, *** p <0.001.

    Article Snippet: To knockdown Smarcc2 , a short hairpin RNA (shRNA) sequence (CCCGATAGTTGATCCTGAGAA) was cloned into GFP-tagged adeno-associated virus (AAV) vector (Addgene) under the control of U6 promotor.

    Techniques: Transfection, Control, shRNA, Injection, Western Blot, Co-Immunoprecipitation Assay

    Correlations between  TPX2  expression in tissues and clinicopathologic characteristics of type 2 pRCC patients

    Journal: BMC Medical Genomics

    Article Title: TPX2 promotes papillary renal cell carcinoma progression by forming a ceRNA with LINC00894

    doi: 10.1186/s12920-025-02120-9

    Figure Lengend Snippet: Correlations between TPX2 expression in tissues and clinicopathologic characteristics of type 2 pRCC patients

    Article Snippet: Short hairpin RNA (shRNA) sequences targeting TPX2 and LINC00894 were designed, cloned, and inserted into the pLKO.1-Puro vector (Addgene).

    Techniques: Expressing

    Identification and Characterization of TPX2 in pRCC. A - B Volcano plot depicting significantly upregulated and downregulated genes. C Venn diagrams illustrating overlapping differentially expressed genes identified from the TCGA database and next-generation sequencing data. D - G Forest plots highlighting 10 genes significantly associated with overall survival (OS), progression-free interval (PFI), disease-specific survival (DSS), and disease-free interval (DFI). H - N Kaplan–Meier survival curves demonstrating the prognostic significance of E2F1, UBE2C, MYBL2, ASF1B, TPX2, PRRM2, and TOP2A in pRCC patients

    Journal: BMC Medical Genomics

    Article Title: TPX2 promotes papillary renal cell carcinoma progression by forming a ceRNA with LINC00894

    doi: 10.1186/s12920-025-02120-9

    Figure Lengend Snippet: Identification and Characterization of TPX2 in pRCC. A - B Volcano plot depicting significantly upregulated and downregulated genes. C Venn diagrams illustrating overlapping differentially expressed genes identified from the TCGA database and next-generation sequencing data. D - G Forest plots highlighting 10 genes significantly associated with overall survival (OS), progression-free interval (PFI), disease-specific survival (DSS), and disease-free interval (DFI). H - N Kaplan–Meier survival curves demonstrating the prognostic significance of E2F1, UBE2C, MYBL2, ASF1B, TPX2, PRRM2, and TOP2A in pRCC patients

    Article Snippet: Short hairpin RNA (shRNA) sequences targeting TPX2 and LINC00894 were designed, cloned, and inserted into the pLKO.1-Puro vector (Addgene).

    Techniques: Next-Generation Sequencing

    Expression and Conservation of TPX2 in Human Tissues and Tumors. A Tissue-specific expression of TPX2 based on the Human Protein Atlas (HPA) and Genotype-Tissue Expression (GTEx) datasets. B Evolutionary conservation of the TPX2 gene in Homo sapiens visualized using the UCSC Genome Browser. C Pooled analysis of TPX2 expression across various tumor types using Oncomine data. Statistical significance is denoted as * p < 0.05, ** p < 0.01, and *** p < 0.001

    Journal: BMC Medical Genomics

    Article Title: TPX2 promotes papillary renal cell carcinoma progression by forming a ceRNA with LINC00894

    doi: 10.1186/s12920-025-02120-9

    Figure Lengend Snippet: Expression and Conservation of TPX2 in Human Tissues and Tumors. A Tissue-specific expression of TPX2 based on the Human Protein Atlas (HPA) and Genotype-Tissue Expression (GTEx) datasets. B Evolutionary conservation of the TPX2 gene in Homo sapiens visualized using the UCSC Genome Browser. C Pooled analysis of TPX2 expression across various tumor types using Oncomine data. Statistical significance is denoted as * p < 0.05, ** p < 0.01, and *** p < 0.001

    Article Snippet: Short hairpin RNA (shRNA) sequences targeting TPX2 and LINC00894 were designed, cloned, and inserted into the pLKO.1-Puro vector (Addgene).

    Techniques: Expressing

    Oncogenic Role of TPX2 in Proliferation, Migration, and Invasion In Vitro and In Vivo. A Western blot analysis of TPX2 protein levels in Caki-2 and ACHN cells transfected with scrambled shRNA (shSCR), TPX2 shRNA (shTPX2), empty vector, or TPX2 overexpression plasmid (OE-TPX2). B Cell proliferation assay showing relative proliferation rates after 96 h. C Colony formation assay and quantification of colonies formed by shSCR, shTPX2, vector, and OE-TPX2 cells. D Wound healing assay demonstrating reduced migration in TPX2-knockdown cells (scale bars = 100 μm). E Transwell invasion assay showing decreased invasion in TPX2-knockdown cells (scale bars = 20 μm). F Representative images and quantification of tumor xenografts in nude mice ( n = 5) from shSCR, shTPX2#1, vector, and OE-TPX2 groups. Statistical significance is denoted as * p < 0.05, ** p < 0.01, and *** p < 0.001

    Journal: BMC Medical Genomics

    Article Title: TPX2 promotes papillary renal cell carcinoma progression by forming a ceRNA with LINC00894

    doi: 10.1186/s12920-025-02120-9

    Figure Lengend Snippet: Oncogenic Role of TPX2 in Proliferation, Migration, and Invasion In Vitro and In Vivo. A Western blot analysis of TPX2 protein levels in Caki-2 and ACHN cells transfected with scrambled shRNA (shSCR), TPX2 shRNA (shTPX2), empty vector, or TPX2 overexpression plasmid (OE-TPX2). B Cell proliferation assay showing relative proliferation rates after 96 h. C Colony formation assay and quantification of colonies formed by shSCR, shTPX2, vector, and OE-TPX2 cells. D Wound healing assay demonstrating reduced migration in TPX2-knockdown cells (scale bars = 100 μm). E Transwell invasion assay showing decreased invasion in TPX2-knockdown cells (scale bars = 20 μm). F Representative images and quantification of tumor xenografts in nude mice ( n = 5) from shSCR, shTPX2#1, vector, and OE-TPX2 groups. Statistical significance is denoted as * p < 0.05, ** p < 0.01, and *** p < 0.001

    Article Snippet: Short hairpin RNA (shRNA) sequences targeting TPX2 and LINC00894 were designed, cloned, and inserted into the pLKO.1-Puro vector (Addgene).

    Techniques: Migration, In Vitro, In Vivo, Western Blot, Transfection, shRNA, Plasmid Preparation, Over Expression, Proliferation Assay, Colony Assay, Wound Healing Assay, Knockdown, Transwell Invasion Assay

    LINC00894 and miR-660-5p Regulate TPX2 Expression. A Predicted binding sites of TPX2 and LINC00894 with miR-660-5p. Dual luciferase reporter assays in HEK-293 cells cotransfected with reporter vectors and miR-660-5p mimics. B Western blot analysis of TPX2 protein levels in Caki-2 and ACHN cells transfected with miR-660-5p mimics or inhibitor. C Laser scanning confocal microscopy (LSCM) images showing miR-660-5p’s effect on mitotic spindle formation. D Representative images of subcutaneous xenograft tumors in nude mice injected with Caki-2 cells and treated with miR-660-5p agomir (2.5 nmol) every 3 days for 20 days. Statistical significance is denoted as * p < 0.05, ** p < 0.01, and *** p < 0.001

    Journal: BMC Medical Genomics

    Article Title: TPX2 promotes papillary renal cell carcinoma progression by forming a ceRNA with LINC00894

    doi: 10.1186/s12920-025-02120-9

    Figure Lengend Snippet: LINC00894 and miR-660-5p Regulate TPX2 Expression. A Predicted binding sites of TPX2 and LINC00894 with miR-660-5p. Dual luciferase reporter assays in HEK-293 cells cotransfected with reporter vectors and miR-660-5p mimics. B Western blot analysis of TPX2 protein levels in Caki-2 and ACHN cells transfected with miR-660-5p mimics or inhibitor. C Laser scanning confocal microscopy (LSCM) images showing miR-660-5p’s effect on mitotic spindle formation. D Representative images of subcutaneous xenograft tumors in nude mice injected with Caki-2 cells and treated with miR-660-5p agomir (2.5 nmol) every 3 days for 20 days. Statistical significance is denoted as * p < 0.05, ** p < 0.01, and *** p < 0.001

    Article Snippet: Short hairpin RNA (shRNA) sequences targeting TPX2 and LINC00894 were designed, cloned, and inserted into the pLKO.1-Puro vector (Addgene).

    Techniques: Expressing, Binding Assay, Luciferase, Western Blot, Transfection, Confocal Microscopy, Injection

    TPX2 as a Prognostic Marker in Type 2 pRCC. A Immunohistochemical staining of TPX2 in adjacent normal and tumor tissues. B Kaplan–Meier survival analysis showing the correlation between TPX2 expression and overall survival (OS) in type 2 pRCC patients. C Schematic diagram of the LINC00894/miR-660-5p/TPX2 regulatory axis, created using BioRender. Statistical significance is denoted as * p < 0.05, ** p < 0.01, and *** p < 0.001

    Journal: BMC Medical Genomics

    Article Title: TPX2 promotes papillary renal cell carcinoma progression by forming a ceRNA with LINC00894

    doi: 10.1186/s12920-025-02120-9

    Figure Lengend Snippet: TPX2 as a Prognostic Marker in Type 2 pRCC. A Immunohistochemical staining of TPX2 in adjacent normal and tumor tissues. B Kaplan–Meier survival analysis showing the correlation between TPX2 expression and overall survival (OS) in type 2 pRCC patients. C Schematic diagram of the LINC00894/miR-660-5p/TPX2 regulatory axis, created using BioRender. Statistical significance is denoted as * p < 0.05, ** p < 0.01, and *** p < 0.001

    Article Snippet: Short hairpin RNA (shRNA) sequences targeting TPX2 and LINC00894 were designed, cloned, and inserted into the pLKO.1-Puro vector (Addgene).

    Techniques: Marker, Immunohistochemical staining, Staining, Expressing